EST 1098848 is a singleton


Sequence

>1098848 (1 EST) Length=497 AGTTAGAAATAAATGATGCGGTCACATAAGACATGCTTCTACTTTGCATGAGAATGATGGCAGCAGTACCTGTCCGTTTT GTTTTATTTGGTGAAGCACGTGAATTGGTTAACTTATCGGAGAGAAATGTAAATGTGCCGAATATGTTAAACTGCCGACA GCTACGACAATTAATATTTCATGAGATATTCAAAGATTTGTCACCAATCGAAGATTGTTGCATACTAGCTCTANATCAGG AATATGTTGATGATCATAACGGAACGTTTACGATCGCTGCGCATTCAGAAATCGCTGTAATACCACCGATAAGTGGTGGT TGAATTTTGAAAATTCCGCTGAAAGAAGGTGCTTTTTTTAAATACGGATACATCTTTCCTTATTGGAGAAAAGTCTACTG TTTATCAGCAGATGTTTTTGANACGTCAGTGCTATGTCTTAATATATTAAGCAAGCGCTGTCGTGGAAGGTTTTGATTGT NTAATTAATAATATTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1098848: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10988482168018AA454349MBAFCX0E06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 4:56:34 on Sat 18 Nov 117.