EST 1098859 is a singleton


Sequence

>1098859 (1 EST) Length=371 ATTTCTTCCTTTTCTTTTCTAGGTTTCATATTTCAAGTGAGCGTCCCTTTCCCGAAATGATGGGAAGTCTTGACTCACAG TTCGATTTAAAATTATCCTGTCGCTTATTCCTACTAAACAACGCCATTTACTTTACCTCACGAAACTTCCAACATGATAA AGATAGGATCATTGTCATCAACCTTGAAATTAATCCTTCTTTCTTAAGGATTCCTTCTTTTATAGTCAAATCCATTCCTT TTTTTATCTTGAAGTTTGAGCGGCATCATTATTCTTCCACATCCATTCAATATCCATTCTGCCCTTTGCATCAATTTATC ATTGGCTTCTCGCCTCGCATCCTTGAACACTTGTATATATTATAACATACT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1098859: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10988592168029AA454360MBAFCX0F06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 16:28:13 on Sat 18 Nov 117.