EST 1098874 is a singleton


Sequence

>1098874 (1 EST) Length=151 TTTATTTTTTTTAAAAATTTTCTTTTTTTGTCATTTTCCACTTTTTTGGGCCCGGGAGGATCCAAACACTTTTTAATTTT TTACCTCAGCACTCACCCATACCCAACCCGCTGTTTTTTGCCCTTGCCAAATCCGGCCCAAGGTCAAATAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 1098874: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10988742168044AA454375MBAFCX0G10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 14:10:31 on Sat 18 Nov 117.