EST 1098880 is a singleton


Sequence

>1098880 (1 EST) Length=335 GTTTGATATATTGGCTGGATAGTTGAGCGACGCACTAATAACTTTTCACTGAACTGGATTGAATTAATTGAAATCATCTT GAAATGAAATAATGAAGTTTCATTTTGTTGGTGGTTTGGACTGCCCGGAATGGATCGTGGCGGAGATGACCTTTTTATCA AAACTTCCTGTATTAAAATTCAAAAATTGGTGTTTGAGCTGTGTGGACTGTCTAATCAATGGTAGAACCGAATGGAATGA TGAACATTTAACAGTTCTCAATGTTGATAAAACTCTTGATGATGAGTCTTTGAAAGGAATGTTAGCAGCGCTTACATTCA TTTTGGAAAAAACCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1098880: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10988802168050AA454381MBAFCX0H04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 14:39:22 on Fri 17 Nov 117.