EST 1098934 is a singleton


Sequence

>1098934 (1 EST) Length=351 GTTTGAGGTAATTATCAGTCTTACAGTGGTTGAAATGAGCAGTAAGTCTCGTGAAAACAGAAATAAAGGCTATCATTTTA TCGTATCTTCAAAAAAAAGGATATCAGATATGTGATATTTTGAGGTCGAATAAGTACCTTTCAGCTGCGAAATGTGCGCT GACGTTTGTTAATGGTGGATCGATCTTCAGCACAGTTTCAGTTCAGTTTTGAAATTTCAAAGAAAAAAGAAGTAAGTGAT TAGAAACTATTTTCAGACACAAGAGATTTTGTTTTGTAAATGGCTGAAGTTCTCTAAGTTACTGGATCGTTAAATTATAA AACTGATTACCGCTTAATAAATTATCCGTAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1098934: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10989342168104AA454435MBAFCX1F01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 21:59:47 on Fri 17 Nov 117.