EST 1098936 is a singleton


Sequence

>1098936 (1 EST) Length=226 AAACGATCGAGGATTAGTATTGCAAATGAAAAATGAACTTAATAATTTCACTTCAACAATCATTTTTCATCCTTATTATT ACTACGCTTCCGATTTCTTTTTCGACTCAAGCGTAATAACTAATGAGATAAAATGTTTGGATTTGACATATTTAATGGAA CAACGATTTCGATATACACATATTCGAGATGACTTAGAATTACCGCATCTTGCAAGTAAACTTCGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1098936: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10989362168106AA454437MBAFCX1F03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 15:6:3 on Fri 24 Nov 117.