EST 1098943 is a singleton


Sequence

>1098943 (1 EST) Length=310 ATCTTGTGCAACGCAAAGAACGACTTTCTCGATTGGGTTGTTGACGGATAATTAAAAATGGACAATCGTAACGGCTGTTT CAATTGTTTGAAAGTCCTAACTCACTTCTCAAAATAGAGCTTGTACAGGAAAAGATTTGTAATGGTCAGTGAAAGGATCT AATTTTGTACTACAGCTGACCAAACGTTCGAATATCAACACCTTTTGGACTATTCTAACTGCTGTCGATGCTTATTTCAA TGAGTATGTGTGTGTGTATCAAAATCACTTTGGATCCGATTAAAAAAATGCTGTCTTAAATCTTTTCCGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1098943: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10989432168113AA454444MBAFCX1G01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 13:28:29 on Fri 24 Nov 117.