EST 1098944 is a singleton


Sequence

>1098944 (1 EST) Length=288 ATTTTTTTTCATTCAGTTCACTATATCAATCATGCGATTTCCTGTTAAAAATCGTTGTTTTAACCGTCGTGTCGAACTTC ATCTAATTGTTCTTTTGATTAGTCAAGCCATCTGTGATTCTATATTATAGCAGACATATATCTAGCTTTTGTAAATCCTA GTCGTATACATCATTTTTGTGTGTTATCAGTGTTTTCATTCCACTACATTTAAGTTTAGCATTATTCTGTAGTTTTGGTG GTACTTTTTTGTAGTCACTTATTATTTCTGAATAACAATGAAGAATAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1098944: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10989442168114AA454445MBAFCX1G02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 16:27:19 on Fri 17 Nov 117.