EST 1116027 is a singleton


Sequence

>1116027 (1 EST) Length=472 CTGTGCTGGATCACAGTGTTATGCTCCATACATAACACAATACATTGCCGTCGCAAATCGTCAGCTAGCTAACGAGTTGG ACAGACAACTGATCGCTGATCGTGAATCATGCGAGTCGTTATGTACTCAGCGACTGTCTACAACGACAAACGATTTCAAC TGTAAATCATTTATGCATAATCCGGAAACTAACGTTTGCATACTTTCTGATGAACGTTCTAAACCACTTGGTCGAGGCAA TCTAGTGAAAGCTGACGGTTTCACATATTATGAGAAGAAATGTTTTGCATCACCACGAACATGTCGCAATGTACCGTCGT NTGAGCGCATACCTCAGATGATACTTGTTGGTTTTGCTGCATTTGTTATGGAAAATGTACCTTCGGTAACGATGTGCCTC GATCAGTGCACAAATCCTCCACCGGAAACTGGAGATAATTTCGAATGCAAATCTGTGATGTATTATTATAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1116027: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11160272199168AA471404MBAFCX2B06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 1:12:44 on Tue 21 Nov 117.