EST 1116116 is a singleton


Sequence

>1116116 (1 EST) Length=436 CGGCACGAGATTACTTGTATCTCATCTATAGTTTCACTCGTTTAAATGCACTTTCGGAAGTGATTGGCGATATGGCCGGT GTAACCCATCGAATAATTGGACTATATGAAGAGTTGGTAAGACTACATATTGATAGGCTTGAAATGGATCGTCCACCATC GACAGTTCCATCCTCGGTGGTAGTTCTTGCTTCAGAAGATCCAGAAAAACCGAATGTAGTGCCAGAGAGGAAGATAGAAG AATTGTATGGTAAACAAGGCCACTTATTTGAACTTGAACCAGACGATGAAGAAGTTGAATTTTTGTTGCAACGAGCAGAT GANAGTCGTGACAGAGAAGAACCGGAATGGCTTGATGATGGCATTGCGATGACTCTCGATTCAGTTACTGTTGCATTTCC GAATGATTCATCGGCACCTCTTGTCTCGAATTTGTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1116116: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11161162199257AA471493MBAFCX3B06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 4:30:35 on Wed 22 Nov 117.