EST 1116135 is a singleton


Sequence

>1116135 (1 EST) Length=432 GAGGTTTAAAATATGTCGAAGAGAGGACGTGGTGGAGCGTCGGGAGCCAAATTTCGTATTTCTTTGGGTCTCCCAGTTGG TGCTGTTATGAATTGTGCCGACAACACTGGCGCTAAAAATCTGTTCGTAATTGCGGTATATGGAATTAAGGGACGCTTGA ATCGATTGCCGAGCGCTGGTGTTGGTGATATGTTTGTTGCTTCCGTCAAGAAGGGCAAACCTGAACTACGGAAAAAAGGT CTCTTTCTGTTTGTATGATGTGCCAAGATCCGTAAAATAGTGGTCAATTTCGCGCTGTTAACGCGCCGATTCGACTAACA TTTAAATGAAGTATATTTGCAATAGTATAATTGAATAAAGCGCCGATGAGGATGCTCGAAGGATGGTTTCGCAACTATAA CTGATTATTCTATGCAGAAATCCTTGGCTGTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 1116135: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11161352199276AA471512MBAFCX3D02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 9:22:24 on Sun 19 Nov 117.