EST 1116239 is a singleton


Sequence

>1116239 (1 EST) Length=501 CATCGCTCTAAAGGGTATTGAAGTCCCAGTAATTGAAAAACGCCGTGTTCTAGTTGATTTTTCGTCTCCAAATATCGCTA AGCAAATGCACGTGGGTCATTTGAGGTCCACAATCATAGGCGACAGTATTTCTCGTTTGCTCACCTACGTTGGTTTCGAT GTTCTTCGTTTGAATCACATTGGTGATTGGGGTACACAATTTGGCATGCTGATTGCTCATTTGCAAGATTGTTTTCCAAA TTTCATTAATGAAGGTACAACCAATTTCGGATCTGCAGGCTTTCTACAAGGAATCAAAGAAGCGTTTTGATGAAGATGAA GCATTTAAAGCCCGCGCTTATCAATGTGTTACCAAGTTACAAAGTTTCGATCCAGATTTCTTGAAAGCATGGCAAATGAT TTGCGATGTTTCTCGGAAAGATTTCAGTCAAATTTACGACCGATTGGATATAAATATTGTTGAACGGGGCGAATCGTTCT ATCAGAAACATATGGTTGAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1116239: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11162392199380AA471616MBAFCX4F03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 16:26:4 on Sun 19 Nov 117.