EST 1116250 is a singleton


Sequence

>1116250 (1 EST) Length=194 GCTGATTAGATAATGTATGTGTGTGTGTGTGTGTGTGTGTGTATGTGTGTATATGTGTGTATGTGTGTGTCACATACTAA TTAATGTGTGTCAACATCTCATCAACATAGATCTCACTCATACTCCTCTTAGTGTTATACACAAAACAAATCTGTCTTTC TCTTATATTCGCGTGAGAATAAATATTATCTCTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1116250: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11162502199391AA471627MBAFCX4G02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 15:37:51 on Fri 24 Nov 117.