EST 1116261 is a singleton


Sequence

>1116261 (1 EST) Length=544 GAGGCTCAGAGAAAGAAATGATTCGTTCAAAGGAAGAAATAAGGAGTGAGAGAACAAATCAGTTATTTCGAATTGAAATT TTCAAGTAACAGCGAACACCTGGCAGTCAAATGATGGTTCGATTTTCAGCACTGCTACTATTGCTAGCTAGTTGCAGTGC TATTTCGAGTTCAAACAACCAAATTGAATAACATATCCATTGACAGTTGGAGTTATGCACGTATACATCGACACAAAGCT TCACTTTTAATTTCCTTTTTTTTATTTTCCTGTTTTTTAACTTAAAAACGAACAAGTTTGAAAGCGTGATTTGTCGGAAA ACCAAAAAAATTTTTTTTTACACATTAAGTGTTTAGAATAATGCTAATGATTCATTACTATAAACCAATTCGATATTCCT TTGTTTTATCCCATTTTTTGAAACGATGAATTCTTTATCTAAAAGTCAAATAGTAAATGTATATCTGTCTTCATTGTAAA TGTTAATCTGTTAAGCCAGCCCACTTCTTACATCCTTAAAAATCTTCTCTAATCAGTGAATAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1116261: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11162612199402AA471638MBAFCX4H03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 16:2:40 on Fri 17 Nov 117.