EST 1116264 is a singleton


Sequence

>1116264 (1 EST) Length=237 CTTGGCTCATGGATCGATGAAGAACGCAGCTAGCTGCGATAAATAGTGCGAATTGCAGACGCATTGAGCACAAAGATTTC GAATGCACATTGCACCATTGGGTTGATTCCCGATGGTACGTCTGGTCTCGTGCCGAATTCGGCACGAGCACAGTCGGTCG TCCTTGGCGGTGGAACTGCTTTGTAATGTTAAGGAGCCTTATGATACGGAATTGTGCAGTAGAATTCAGGATTTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 1116264: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11162642199405AA471641MBAFCX4H06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 12:17:8 on Mon 20 Nov 117.