EST 1116266 is a singleton


Sequence

>1116266 (1 EST) Length=493 TCGATCTTGAAATTGGACAGGAGAAGATTATGGGAGGTTCACACTCCCAGTCGTATGATTTGAGCCATGAATCGGTAAAA TCAGTTCAGGATAAACAGGATATAGTTCCTAGCAATAATGTCGTAGATGGTACACTTATTCATATTACTTCTTCCGATAA TTCAAACATTTCATCAAATGAACAGGAGTTGCAACGAATACATCCACCGGAGGAGATGCCACTGACACCAGAGGAAATAC CAATAGAGAACATGCCAACAACAAAAGCCACAGCTCCTAACATCATCGAAACAGCTCTTGAATAATTGATTTTTCTCGAT TTACTGCTATTAGCTGTTATAGTATTTGGTGACAGCATGTTTTACCATTCCAGGCGCTACTGTCTTTACTTGAACTTGTT AGACTTCTAGATGACATGTTAGAAACAACCATGACCACACATTGCACCACACATATGGTAACTAAAAAATTCACTTTATA TTATTTGCATTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1116266: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11162662199407AA471643MBAFCX4H09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 4:42:5 on Sat 25 Nov 117.