EST 1116282 is a singleton


Sequence

>1116282 (1 EST) Length=496 GAAGATCGTACTTCAGGATCTCTACATTGCATCATTGCGTTCACTTACTTACAGTGATTTTCACATGTTGAAAGAAAAGG ATATTGACTGTTTGGTGGTTTATTCGGAATTTCTCGATTTCGGGTTTGATTTAAAGAACTTACTTCCATTATTTGATGAT GAGACAATGATTATCATCCAAAATCCTTCAGTTCTGTCAATTTCAATGGATGTTTTTGCCCGAATACATAAATGGCGATG CAAGGAATCACGTGTTTGCGTTGCTTGCGATACGGATGGATTAACAATCTCAGGTTTAATTGTGGCGCGTTATTTATCAC TTTCTACTCGATGCAGTCATGAAGATGCAATTAAAGCTGTCAAAATTTGTCATGAATCCTTTTTTCCACTTCCATACGCT CAGGGTGATTTTCTCAATGCTGAATTTGAGGAAGAAGAACCGATCAGTTTGAACTTCAAGCACCATCGTCTGACTCTAAG ATAAATTTCGATCGCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Processing,


Cluster Information for 1116282: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11162822199423AA471659MBAFCX5B03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 0:39:39 on Thu 23 Nov 117.