EST 1116286 is a singleton


Sequence

>1116286 (1 EST) Length=470 CGGTGGGGGCCGCTCTAAAACTAGTGGATCCCCCGGGCTGCAGGAATTCGGCACGAGCTATCACCTTAGCAATGATTTTA TTTGAGGTGGGGCGAGCATTTCTGCGTGATTACGTAGATACACGGGGCATCCCGTGTTCGTATCACGTTAAGGTCACCTT TGTGTGATTATACGGATTGAGGCATGGTGATATAAAAAGCCGAACAGATAGACACGAACTGTTTATAAATGTTATAAATG TTAAGGCTAACTTATGTATTTAATTTGTATCGATCTGTTGAAGTTTCAAATAAATAATGACCTTTTACTTTTAAAGATTC CGCAAGTACCAGACAAATTTAGAGTTGTTGTTATCAAATATAAGAAGAAATCCAAAGGACATTACAATTCAGAATGATGT GACGATTATTTTTGACAATAATAATTGAGTCTTACTTTTCTACAGTACAAAAATATGTGCATGAATTATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1116286: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11162862199427AA471663MBAFCX5B07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 4:25:54 on Fri 24 Nov 117.