EST 1116302 is a singleton


Sequence

>1116302 (1 EST) Length=341 CTTAAAATGGATACGAAAGAAACTGGTTGTGAATCACTGCAGAATAAACAGACTAAAATGAATTTTGAATGTGGAGTTAC ACATAAAAGGGAAGGATGGAAGGCGGATGAATCACTAAAAAATTTGGAAGACAATATAATTAATTTAATCGAAGCGGAGA TCATGCCAACGCGAACGGATATTCAATGGGCGGATATATCTGGTTTGGAGTTGGCAAAAAAAGCACTTAAAGAAATTATC GTTCTTCCGTTTCTCAGACCTGACATTTTCAAGGGTATACGTGCACCACCTAAAGGTGTGTTGCTTTTCGGACCACCTGG TACTGGCAAAACCATGATTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 1116302: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11163022199443AA471679MBAFCX5C12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 21:4:39 on Sun 19 Nov 117.