EST 1116310 is a singleton


Sequence

>1116310 (1 EST) Length=445 GTTTGAGGCAGTTATTGTTAGTGACAGTATGAACAGATACTTACTAGATTTGGCTCGTGTATCTGCACGTCATTATAGCT TAAAGCCACCAGGCCGCAAGAATTGGCCACGTCCAATGATGTTAGGGCCACAAACATCTAAACATCCCAAGTTTCCGGGA TGGTCACTTTACTATCTACCGGTGACCGATAACAAGTACCTGTGGTTTATAATTATGTCACTTTTTCACTTTACTGGATT TACGATACCTATACTTGGCGTCTGCAAGATGCTCAAAACGATGAATCAGTAGAAATGCGACGAATATTTCGAATTCTGGA TTACCCAAGTCTGTGGTTCAGAAAATTATTCGCCAGATAATCATTTTTAGATTTTTCTAGTTATTTCCTTTGTAAATTGA TTTGTTGGAGAATATTTGATAGGCATTGGAGTANAATTTGTAACG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1116310: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11163102199451AA471687MBAFCX5D11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 12:31:58 on Fri 17 Nov 117.