EST 1116315 is a singleton


Sequence

>1116315 (1 EST) Length=496 GGAATGGCGTTCACCCGATTATACGGCAAGACTGCTAACTTTTTTTGGCTTAGTTTATAGCCTTTGATGATGTTGAATTT GGACCAGGAGTTGTTACTTTGATAAATACTTTTCATTGTATTGTCGATCTTATTGATATTTCTTCTTCCATTGCCTTGCA TCTTGATATATACAACAAGTTTTAAAATAATACCCAATTTCAATAACAACTGCCTATGTAATTCTCTTATTATAGGAAAT TTTCAGGTGCATCGATTTAAAAATGGTGATACAAAAGTGCGTCTAAATTTAACTGATACGAGCATTACGATGCTCGTCAT GGATGTCGGTACAGTGAANCATTTATCAAATTCTTTGGATCGACGACTGCCGAAATATTGTGTCGAATGGGGTACTGTTG CTAGAAAAAGATCCCGAGTTATTGCTGCCACCCATTCTCGTGTACTTAACCAGTTGTAAATGATTTAACTTCTTTATATA ATGTAATTTTCGGTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1116315: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11163152199456AA471692MBAFCX5E04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 16:6:34 on Tue 21 Nov 117.