EST 1116335 is a singleton


Sequence

>1116335 (1 EST) Length=145 GTGACACCATTCGTGGACGTGATGGCTATGAGTAGGATGGATGCCGGATCAGAGTGGAGATGACTCGCGGAGTTGGTCCT CGTGGTCCACGGGGTCGCCCACTTTATGGTCCAGATCGTGGGGAACGTGATCGAAGACCACCACC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1116335: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11163352199476AA471712MBAFCX5F12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 8:25:6 on Fri 24 Nov 117.