EST 1116337 is a singleton


Sequence

>1116337 (1 EST) Length=323 GAATAAATAAGCGGAATTTTGTTTCATAAAGTAACAATTACGCCTTTCAGTTTTTTTCGAAATTCAATTTGATTTTTTTG GAAAAAGTCATATTGAACATTTTAATGGTCTCTTCTTCGTTCTGTCATAGCTGTTTTGTAACAAATGCGTAAGAGCCATT ACGCTGATTTTCGGTACGCAACGAATTTCACTACTTTAAGTAAGCATATTGTTATACTCAGTATTGACCGATTTGTTTAA AGAATCGGTCTGTGCGTTAAAACTGAAGTTTCATTTTGTAAAGACTGTACATAATTTTAATAATACATTACGACCTTCTT TTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1116337: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11163372199478AA471714MBAFCX5G03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 1:6:52 on Tue 21 Nov 117.