EST 1125340 is a singleton


Sequence

>1125340 (1 EST) Length=618 CAAATGTGGAACAACTAAATGGTGATCCATCAAACGTTACAATTATGGGGTGAAAGTGCNGGCGCANCTGCTGTTTCCGT TCTNGCAGTATCACCCAGAACAAAAAATTTATTGCATCGAGCTATCATGTTATCCGGTTCCTCAANAGCTGGTTGGGCTA NTCATCGTTTTGGACNACCGGCNTGGAGTGTAAACAATATTGCGGCATATATTGGATGTGAGAAAGAACTGGATAANCAA ACAATAGAACCATTATTNAAAGCTTCCGGATTGCCAACTCTCAGGGGGAGAATGTAATATGCAAGAAAAAATACCGGAAT GTTTAATTAATAGCGCAGAAATGAGTGGTATGGAATTGGTTGAATGTTTTAGAAATGAACTCAATCTTTCATCATTTTCA TTCCGTTATGCAATTGCTACTGAGCTAGGAATATCGAAAATGGTTGTGGATGATGAATTGATACCACAATCTGGTGCTGA ATTAATTAGCAAGAATGCACGAGTTCCAATTATAATTGGGTGTCGCCCAACATGAAATGGGCCCCTAAGAAAACTCAAGA TTATGGTTTGAATGAATTTAAAGATGTTTCCATTAAGGATTGTTATAGTAACATTCGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1125340: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11253402209408AA480710SWMFCA2064SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 5:8:54 on Sat 18 Nov 117.