EST 1125344 is a singleton


Sequence

>1125344 (1 EST) Length=898 TTGAGATGGAACGTAAAATATGGCATCAATTCTGTGCTTGAATCCTAAAGCCGAACTGGCTCGTAATGCGGCAGCATTAG AGTTGAATATAAGTGGTGCAAGAGGACTGATGGAAGTAATGCGTACTAATCTTGGGCCAAAGGGAACAATGAAAATGCTT GTNTCTGGCGCGGGTGATATCAAATTGACCAAGGATGGCAATATATTGCTACATGAAATGCAAATTCAACATCCAACAGC TGCAATGATTGCAAAAGCTACAACCGCTCAAGATGATGTGACTGGTGATGGCACCACTTCTACTGTTCTTTTTATAGGAG AACTCCTTAAACAGGCTGATCTNTATNTTTCTGAAGGTGTTCATCCNCGACTGATAANAGAAGGCTTCGAGTATGCGAAT AAGAAAACTCTTGAATTTCTGGAAACTTTCAAACAAACTCCAAAAGTGGACCGTGAACTGCTGAAGCGAGGTAGGCACAA ACCTCACTGCGAACGAAACTTAATCGGAAGTTGGCTGATCATATAACGGACTGTGTTGTGGATGCTGTGTTGGCAATACG AATTGGGAAATGATCTACAGCCAGATTTACATATGATTGAAATGCAGGAGATGCNACATGAAAACGATATGGATACTAAA CTGATACNTTGGATTAATTTTGGATCATGGTGGTCCGCATCCTGATATGCCCAAAAATCTCAAAAATGCATGTTTTTTGA CATGCCACATTTCCTTNGGAATATGAGAAAANCCAAATTGAATCCCGGTTTTTTCTATAAGTTCGCATCTGAAACAAAAA AAAACTTGTTTGCTGCCGAAAGAAAATTTTTAATGGCGGAAGAATCNNAAAATTGTTGAATCTGAAAAAAAANTNTGTAT CTGGCNAAAAAATGATGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1125344: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11253442209412AA480714SWMFCA2068SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 19:13:11 on Sun 19 Nov 117.