EST 1125348 is a singleton


Sequence

>1125348 (1 EST) Length=745 CAGAATNNNANTGAATTAGTGTGGATCTTGTGGCTGTTTTTCTCTNCCNTTCTTTAACGGTCATAAAACGCNGTGGTTTG TGGTNACGCTACCANNTTTTGTCTTTTGNTGCAAGGGTAATTAATTATCTTGNTTCATCTTGTGGTCTCCGAGTCACCGA TACGATTGGATTACGTNTTCAGTGAAAGGANTATGAGTCGTGAGCTACTTCATCCTGATNAGGANGGATTTTTCACTTTC GCCNTGAAACTTGTTAATCAAAGCANGAACACTTGTACCAGCTGCATTTGAACANCCTTGTTCAGAAGTACANNCGTAAA TTGTCAGACTCGAGTTGGTAACAGAAACAGATCAAGCGGTTGAGAAAATGTTGATCGAGAATCTTTCGAAAGAATTCCCT GACCATTAGTTTATTGGTGAAGAATCTGTGGCATGTGGTGCCACACAATTGATTACNCTGATGCNCCTACCTGGATTNTT GACCCCATTGATGGCACCACGAACTTCCTCCATAGAATTCCACTTATCCCTCTATGTGTTAGGACTGGCTATCCCAAAGC CGTTACCCGCCGGAATTGTTGTATCATCCCCTACTGCAGACTTTTNTNCGGGCTCCATCAAGACAAAGAACTTCCTCGAA AATGGGTTTCCNAATGTCCATGTTTCCGCNNCCCNTNGAAATAACTTCGAATCCCTACTGTGGTCGTCTCCATGGGGAAT CATATTTTTGGGTTGAATTCCGGCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1125348: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11253482209416AA480718SWMFCA2074SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 16:13:24 on Fri 17 Nov 117.