EST 1125357 is a singleton


Sequence

>1125357 (1 EST) Length=537 TATGCTTNNAGTACATGGTAAGATAGCGATATTGAGTGTATTCATACATATAGTGCTACTATATTCAATATTTGATATAT ACTACTCGTCACCTTTGGTTACGGGCCTTCATCCTTACCCTATCACTAATGGAAAAGGCCTAGCTGATCGTCTCGTCATT TTCTCAGCTGATGGTTTGCGAGCAGATGCATTCTTCAATCATCCTGAAAAATCACCATTCTTGCACGAAATTATTAATTC AGGCAAGAGTTGCTGGGGTGTAAGTGTAAGTCATGTACCGACCGAATCACGTCCTGGACATGTNGCAATGCTTGCTGGCT TTTTCGAAAATGTCAGTGCTGTCGCCCGTGGCTGGAAGCATAATCCGGTTCCATTTGACAGCATCATCAATAGGTCACGA AAACATTTGCTTTTGGTAGTCCGGACATTGTCTTGATGTTTACAAATGATGTCAGCCATGCNACCGCAATGGTTTATTCT TCTNAATTAGAAGAATTCCCGCCNAATGACGCTGCGCAACTGGAACGGGTGGGTTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1125357: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11253572209425AA480727SWMFCA2085SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 7:38:36 on Sat 18 Nov 117.