EST 1125381 is a singleton


Sequence

>1125381 (1 EST) Length=370 CAAGTTTGAGGATTCAATAAGCGCTCCGCAACAATGGCAAATGCGCAATTCTCATTTTTTACGTCACCATTACTGCTCTA CGTTCTCAGCACACTGATATTGTTAGCAACACCTCAGAGATTGATTCCGATAATGAAAGAACTGTGCTAAACGGACTTTT ACGGATCGGATACATCAATGAAACAGTGTTACCATGGAACAGTGGTCGACCACTTCTGATTAGATATATTTGGGGAATTA ATACTAACAATGGCAATGAAATTTTCGCCTTTGAAGTCTTGTAATGCTATAAAATTGTGTGACGTTTGTTGTTGAATGAA ACTGAAATTTGTTATTGTCACTATTTTCGACATTAAATGGTTTTTGCATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Processing,


Cluster Information for 1125381: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11253812209449AA480751SWMFCA2124SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 0:45:20 on Thu 23 Nov 117.