EST 1152906 is a singleton


Sequence

>1152906 (1 EST) Length=152 AGTTAACTTATTAGATGAAAAAGCTGTAAATGATATCTTTGAAAAACATAAAATTGATTACGTCATACACTTTGCTGCTT TAAAATCCGTATCAGAATCAACTCAAAAGCCTATACAATATTACAACAATAATTTCGTGGGTATACCCGGNT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1152906: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11529062245741AA508301MAAD0469.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)


Date: 13:51:45 on Thu 23 Nov 117.