EST 1152913 is a singleton


Sequence

>1152913 (1 EST) Length=252 AGAAACTCAGGTGAAAAACTATCCAGATATTATACAATCTAAAGAAAAATGTCTGCCTCAACAAGGCAATTATGAATTTG CGAGTACACTCGTCTGTGATCCGGATGGCTTGTTATCTGTTGCACAAATTAACATGTTAAACACCAAACTGCATCACATC AGAACATCTGTTAACTTCGATAAACCTAGCTGTGATGTAAATAATCCACGACCAGTAATAGGAGTGGGCGATATTTAAAA AAGATAGATGTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1152913: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11529132245748AA508308MAAD0443.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)


Date: 4:30:43 on Fri 24 Nov 117.