EST 1152934 is a singleton


Sequence

>1152934 (1 EST) Length=397 GCACGAGTTCAAGGTCATACACTTAAACAACAAGCACAATTGTTTAGTGATAAATGTACACAATGTGAAAATAAACAAAA TAAATGCAAAAGCTATCAAAAAATTGTTTACAAAATAGGTTTAATAAGCTTATCTCCACATATCTGACAGTACGACTTCT CTCNTAGACTATGGGGTTACCTTTCCTTTTTGAGTGTTACTGTTCTCCAGCCAAATTATCCTGTTATGATAGCCACTAAA GAGATCAGTTTTCCACTCCATATTAAATCNTTTAGGTAGTCTCAAACCCAACTATCACATCCACGTAGCAACTATAATCG AGATTTAACTATATCTTTATCGTAATTTGTTCCCATTTTTTTGACTTACCTTTCAATCGATCATGTTTTGATATCCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1152934: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11529342245769AA508329MAAD0408.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)


Date: 16:28:41 on Fri 17 Nov 117.