EST 1152935 is a singleton


Sequence

>1152935 (1 EST) Length=422 GCACGAGATCGTCTACAATGATTAGTAGACTTGACTAGTTAAAATAAGAAAAATTAAATTTTCCATCCTTCATCTCTGAT AATGGAAAATTATTGCGTAATGAGAATTTACTGTTAACATCGCATTTATTTGGCCACTAAAATTTATGAACTATTCTTCA AAAAATTGTTCGTCCGGTCAGCGATCAAATTCCCATTTCTCTGTTGTCATCTTTGTAAGCCCAAATAAATGAGGATTGAG CTCTGTGACGGNNCGTGATCTTTATAGCTGTTGTCCTCCGNAGGGATCATAATCTATAGTTACTAAACAAATGATATAAC TCAAAGTTCGATTGCTAAGAGATGTTTCCCGTGTTTCATTCCTTTCACCCCTCCCAAAAGATCATTGATGACCTTTCTCT GTTGTTCCGTCTTCNTGTGGGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1152935: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11529352245770AA508330MAAD0407.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)


Date: 1:2:58 on Tue 21 Nov 117.