EST 1153582 is a singleton


Sequence

>1153582 (1 EST) Length=410 CCAAGTTTGAGAACTTATGAAGATCGAAGCAGCATGCGATATATACATGATTTCAAATGTGGTCCAACACAGCTTGTTGA AGATGAAGTCCGGGGTGGTATGGTTGAATTTATTACTCTTTATATCACTGGACAAAGCTTTATGCTGCATCAAATTCGAA AAATGATAGGGATGACGGTAGCAACTTTCAGGGGTCTCTGTGGCAAAACTGAGGTTGCAAATACATTTCTGAGTGAGCGA ATGGATGTGCCGAAGGCACCCGGTCTAGGTTTGGTGTCAGATCAAGTACACTATGAAAGATATGACAAGTGGCATGAAAA AACACACCAGACATTGAATAACTGGGGTGAAGAAATTGAAACTAAGGCTGATGAATTTCGACAATTTTACATAATTTCGG AAATTTACCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1153582: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11535822246796AA509347MBAFCW1B12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 17:49:30 on Tue 21 Nov 117.