EST 1153659 is a singleton


Sequence

>1153659 (1 EST) Length=286 GTGGAATTTTCTCATAGATCTGGTCGAGATCTGTTGAATATAGCAAAAAAGAGACCAAATATCATTCCCATTGTAGACGA TGCTCGTCATCCTCAAAAATACAGGATGCTTGTCGGAGTGGTGGATACGATATTTTCTGATGTAGCGCAGCCTGATCAAG CCAGAATTGTTGCTAGAAATGCCCACCATTTCTTGAAAAATGGCGGTCATGTTGTAATCTCGATTTAGGCGAATTGCATT GATTCGACGGCAGCACCGGAAGCAGTGTTTGCTGGTGAAGTGAATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 1153659: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11536592246873AA508996MBAFCX6A08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 7:20:35 on Mon 20 Nov 117.