EST 1153664 is a singleton


Sequence

>1153664 (1 EST) Length=393 CTTCCATCCCTGTAGCTTTACAGATGCAGTTGCACAAATTGAATTCTGTAAATTATACTCTTGTCTTTTAATGAGCAGAA TTCCGACTTCTTATTTTGAGTGATCAAGTTAATTTCAGATAGTTAAAGGCACTGTTTCAATACGTAATTGGGCTGAAGAA GGCAATCGAAGAGTGGAAGGAAAACTAAGGACAAGGGATTGTTGGTTTCATAAATATCATCCAAATGGTTGCCCATTATC AGCTGAAGATTGTTCTTACAAACATTGAATCTTTTACATACATCCGCAAATTGAATTGGATTGCAGATTTATTCAGCTCA CAATTTGAATACAGTGAGATTTGACCAATTGTAGATAGTAAAATCTTTTCCTTTTCTGATCTAATCTTGTCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1153664: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11536642246878AA509001MBAFCX6B01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 7:29:47 on Sun 19 Nov 117.