EST 1153668 is a singleton


Sequence

>1153668 (1 EST) Length=328 CCCAAGTTTGAGAATTACATGCAAGAAGTGTGATCGCTGTACGGTTATTTGGTCGTGCTCGTTTCGTAGACCTAGAAGAA GATGGTAATGCCGTAACAAGCCGTCAAAACACATCCTTTGTTGCGGTTGGCATCACTGCTGATAATTATTCCGTTTGTAT TATTGATGAAGATGAGATTGAATTATGGAGGTGGCCTATTCCGATGCTAAATGTATTTCGATTAGGCACGATGATGTTAG GTTTCCTGGATCGAGAAAATGATATGAAAATTGGAAGTACAAAGATTTTATATTTTCGAAACACCAAAGAAATATCTGAG TTTCTGAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1153668: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11536682246882AA509005MBAFCX6B05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 6:31:29 on Thu 23 Nov 117.