EST 1153679 is a singleton


Sequence

>1153679 (1 EST) Length=413 ATTTTAAAGTGTTAGAATTTAATACTTTAAAAGTTTATAAATAATCAAATACTTTATTAAAGATAGTTTTTGATTAGGAA AAAAGAATTTTTTTTAAAAATATATAAATATTTTAGGTTATCAGTCTGGTCTAATGGTTTATTACTAGAATATATTGACG GTGATAAAAGAACTGAAACAGCATTTCATCCTATAAATTCACTTCATTATTGTGCAGCGGTACGATATGTTAATGTTACC GGATATGCAATTGAGGGTGGTGGTGAACGATTTCTACCGTTGGATTCACCATTTGCAACCGGTGAAGATAACCAACATCC ACCAATTTTTGCTGCTATTTTCAGGAGAACTACCGGAATTAAGGTTAATTTTATATATAAAATGAAAAAAAGTATAATAA TAATTTTGATAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1153679: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11536792246893AA509016MBAFCX6C06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 14:23:54 on Mon 20 Nov 117.