EST 1153681 is a singleton


Sequence

>1153681 (1 EST) Length=297 ATTTTTAAATATAGAATGTTAGTTATGTCGGCAACGTCGCTGCTGTATTCATTTTCAGTGCATGAAAGAATGTAATTTTC CCTTTTTGCTCAGCAGACAAGGTAAAGGCATCATTATTGTGATGGCGCCAGGAAGGTATACCTTTTGTTTACCTCATCGT GAGTTGTGTCAGCTTCCTTTTATTATTTTGTGGAATTTTTTTTAATTCTTGGTATGTAATTTTTATGAACTTGTAAACGC ATTCTGTGTGCACTATTTTGGCTTGATTTGCATTCGGATTTCTATAGAATGTTTCCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1153681: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11536812246895AA509018MBAFCX6C08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 6:42:4 on Sat 25 Nov 117.