EST 1153698 is a singleton


Sequence

>1153698 (1 EST) Length=169 GCCATGTCGTGCAAATTTCCAAAAATATATCTCATCTTGCTTCATTAATATCTAGAGCTGCTACTTTTGCACTATACTGG TGCAATCTGATTCGATTTCTTGGAAATACAATATTCCAGATATTTCATTGATGTGAGTTTTGTGTTTGTACCGATCAGAT AAGTGTAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1153698: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11536982246912AA509035MBAFCX6E03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 13:22:10 on Thu 23 Nov 117.