EST 1153707 is a singleton


Sequence

>1153707 (1 EST) Length=463 ACCACTTCAAACAGCTATGTTTCCCCATCAACGAGTAACAACAATTTTTCAAATAACTTTGCGAAATCGGTAACTTTCGA AAACCAGCTCGACAAACTTACTGACTTTGAACGCAGTTCAAAATCTTTCAGTAATAACAGCAATTTATCAGATAAGGCAT CAAACAAGGCAACGAAGAAAGCAAAAAATGAAGCAGTTGAATTTTATGATTCGGATGAAGATGAAGATCATGAATGTTGG GTACGGCATCATCGAGAACAATTGAAAATCGTAAAACCTTTGAACAGTTTTTCCAATGAAGATGACGGATCGAAGCAAAA AAGAGATCAGGATCATGCAACTGATGCAGTACTGTCTTGTCCTGCATGTATGTCGTTATTAACACGAGATTGTCAAAGGC ATGAACTGTATCTTAATCAGTATAGGGCTATATTTGTGGAGAACTGTAATGTGGTAAAAAATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1153707: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11537072246921AA509044MBAFCX6E12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 0:13:2 on Thu 23 Nov 117.