EST 1153747 is a singleton


Sequence

>1153747 (1 EST) Length=445 TGATACCGACTCAGTGATGGTGAAATTTGGTGTTAAAGACGTCAAAGCAGCGATGGAACTTGGTTTGCATGCTGCTACAG AAGTTAGCAAGAAGTTCATACCTCCAATTAAGTTAGAGTTTGAAAAGGTTTACTCACCCTTTCTGTTGATAAATAAGAAA CGCTATGCTGGTTTATATTTTACAAGACCTGAAAAGCATGACAAAATTGATTGCAAAGGATTAGAAACAGTTCGGCGTGA TAATTGCCCACTGGTGTTCAAAGTTTTGAGTACATGTTTAGAAAAAATGTTGTTGGAAGGTGATGCTACAAGTGCTCTGG AACATGCTAAAAAGGTAATATCAGATCTTCTTTGCAATCGTATTGATATCTCAGAACTCATAATCACCAAAGAATTAACT CGATCAAGTAATGCTTATGCTGCGAAACAAGCGCACGTAGTTTTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1153747: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11537472246961AA509084MBAFCX7B01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 6:8:50 on Sun 19 Nov 117.