EST 1153761 is a singleton


Sequence

>1153761 (1 EST) Length=460 GTTTGAGCGAGAATGAGTTTGCATGTACTTCGCAGATGTATGTCGTTAAGTGCTGTTGTCCGAGCAACAGAACATATTGT TAGATCACCTGTTCAGGTACACGGAGTAGAAGGACGATACGCAGCGGCACTATATTCAGCAGCAGTGAAAGACAAAACCC TTGATACTATCGATAAGGATCTCAAATCATTACAAGATGTTTATAAAACTAGTGTTAAATTTAAGAACTTTGTATTGGAT CCAGCATTAACACCGTTATCTAAAGTGAACACAGTGAAGGATGTTGCTAAAAATCTAAATGTAAGCAAGGAAACGCTCAA TTTTTTAGTGCTGTTGGCGGAAAGTGGACGACTAAATCTGCTTGAAGAGATTATGAAATTGTTCGATTCGATCATGCGAG CGCATCGCGGTGAATTGGTTGTCGAAGTAATTACTGCTGAGCGGCTCAGCAAGAAACATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1153761: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11537612246975AA509098MBAFCX7C03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 1:47:18 on Sat 18 Nov 117.