EST 1153766 is a singleton


Sequence

>1153766 (1 EST) Length=318 GTTTGAGGATAATAGTTTCCCGCTATTGGTTCCGTATTGATGTACGAGAATGATGGATAATGGTTTCTGCTAAAAGTGAT TCAGACATTTTTGCTATCCATAAAAGTACGGAAATTGTGGAACGATGATAAGTTCTAATCAGATAAGAGAAACGACACAA ACGTTTGATTAGAAAGAAAAAACGTTGTGAAACCAAGCGCTGGTATGTTTGCAGGAATAAGCAGTTCATAAGGAGCGCTA AATGATTTCTTGAGTTGTGCGCCATTGTAGAATGCTTTATTTATCTGGAAATTGACGGAGTAAATCTTTTTATGAATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1153766: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11537662246980AA509103MBAFCX7C10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 22:41:51 on Tue 21 Nov 117.