EST 1153779 is a singleton


Sequence

>1153779 (1 EST) Length=344 CATTAATTGTGGAAAAATTCGGCCAACCAATGAAAGGAGAAAGTTGCAGGTGACACGGAAAATAAAACAAAAATTGTTGA ATATGCCAAAGAAAGAGCGCAAAGTGTATATTCGGGAGTTACGACGGAAGCACAAACCACATGTCGACCTTGTACTTCAG TGCAAACATTTGTGGGAGAAATTGCGCTGTGGATAAACGAGTGAGACTGAACGAAAGAAGTTGGTCATCGATATTTATGG AATAGTGAAGGGAAAGGTGAAAGAATTAATATTCGCGCACGATGCATGCCGAATTGTAAAGTGCATGGTACAAAATGGAC GGAGCGATGTACGGAATGCTCTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1153779: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11537792246993AA509116MBAFCX7E01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 2:42:42 on Fri 24 Nov 117.