EST 1153781 is a singleton


Sequence

>1153781 (1 EST) Length=368 TAATTTTCAATTGTTCAATCAATAAACAGTTTCGTGTGTCAGTGCAGTGGTTGCGTGATGGTCGTTTAATTGATCCCAAT ACAGCTTCTTCACGTCTAGCCTTTAAAGCTGGCAATCAGTTGCTGGTGCTAAGTGAAGCGCGAGCTTCAGACAGTGGCGT TTACGGATGCGAATTTAAAGTAGGTAATGATGTACTTTCACGGGTGTCTTCGACGTTAGTTGTTGAAATGGGTGCTGAAG ATGACTGGAACAAGAGACGTGAAGATATTGATAAGATTTCAATTGATAGAAGTTTGCAATACTCACTTGCTATTTGCGCC ATCACCTTCCTTTTACTAGCTTCTGGTATATGCTCCGTAATTTTGCTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1153781: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11537812246995AA509118MBAFCX7E04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 8:33:27 on Fri 24 Nov 117.