EST 1153810 is a singleton


Sequence

>1153810 (1 EST) Length=163 TCATTATTTGTATGCTGCGACAATGACTATTCGAAAATTCTCCATTGATTTACTATTTTTCAAACGTACCTACACGTTGC TTAAAATAGTTTTTCCATTTTCACGATGTCGAATAATACCGAGTTCATTTCTTATTGCTGTATGTGTTATGGTTGTTTCT ATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1153810: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11538102247024AA509147MBAFCX7H01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 4:27:52 on Thu 23 Nov 117.