EST 1153812 is a singleton


Sequence

>1153812 (1 EST) Length=286 GGTACGCAAGCCTTAATATTTGTAATTGAGGCTCCCGATCGAGAGAGAGTAGATGAAGCAAGACTGGAATTGCATCGAAT CATCAACGATCGCGAAATGCGAGATGCAATCATTCTTGTTTTTGCTAACAAACAAGATCTTTCAGAAGCGATGAAGCCTC ATGAAATACAGGATAAATTGGGACTGACACGAATAAGAGATCGGAATTGGTATGTGCAACCGTCTTGTGCTACAACTGGT GATGGTCTTTATGAAGGCTTAACATGGCTGTCATCAAATTGTAAGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1153812: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11538122247026AA509149MBAFCX7H04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 2:49:37 on Thu 23 Nov 117.