EST 1153858 is a singleton


Sequence

>1153858 (1 EST) Length=597 TCTAAAACTATTGGATCCCCCGGGCTGCANGAATTCGGCACCAGTACTAATGCATCTTTTCGGTACTTTCCTATTGATTA GGGGCACTGCTTTTGTGATTCAAGCCTGTATCCCATCGCAAGGACAGCAAGGACAGCAAGGGCCTCCAGGACGAGATGGA AATAACGGACCATAAGGACCGAAAGGACCACGAAGAGCTCAAGGAGAAAGTGGATTGAAAGGCTTGGTTGGAGATCCCGG AGTTCGAGGTCGGCCANGAATGGAAGGTGAGGAAGGGCCAACAGGCCCACCCGGTGATGAAGGACCACAAGGTCAGAAGG GACTAAATGCANCAGGAAGATAAAAGGATTTAGCGATGACAATAAAGCTATCTCTCACAGTGATATCTGTTCTCTTATTT TGGTTGTTTTTGTTTGCACCAATATATCGTCAATATATTCTTCCCATTATGCCACTAAATTGCTAGTTTCTAATCACCTC ATTCATTCATGCCATAACGGAAACTGCTTATGAAGATTTGAACTTGATATTTAAATTTTGAAAAACAAATGCTTTATTAT ATTCGCTACCATTGTAAAGAGATAAAAAAACTTTCTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1153858: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11538582247072AA509195MBAFCX8D08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 23:5:6 on Wed 22 Nov 117.