EST 1153917 is a singleton


Sequence

>1153917 (1 EST) Length=251 AGAAATTTTTTATTATCAGATAGCAAAACAAAACGAAAGTTAGTTATCACGAAAATGAACAAAAGAGGAAAGGTTGACAT CAGAAAGATGAAGCAAACAAAATGCAAAAGTACGCAAAGGCCCTCAAAGCAACTACGTCAACTTAATCTCTCATGATGTT ATTTAAATTCAATCCTCTTAAGAGACTACCGTACATTAACAAGCACTAGTTTGCATTTAAACTTGGTTTTTTTAATTCAT TATTGCAGAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1153917: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11539172247131AA509254MBAFCX9B02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 20:39:54 on Tue 21 Nov 117.