EST 1153955 is a singleton


Sequence

>1153955 (1 EST) Length=403 AGATAACAAAAGATTTGTTTGAGCATTGACTGAATGGTTTCCAAGGAATGTACTAGTGAAATGCCAAATTATCGATCTGT GGTGGATCGAGTTTACAAGCGTCATATTTTAAAAAATGATGGGAATGGTTTATGCTATTTGCGACATCCAAGTGGAGTAA TAGTTGTGACATTGTGTTAAAGTCATGAATTGATACAAAAGCCAATTACAAAAATTGATTGGCGGATGAAGAAAAATAGA AGAATTGATCGAAGTAAACAGAAAGTTAGTGGAAAAGGGAAAAAAGGTGGACTAGCACTACTACCAGATACAAAGCTATG TATTGTGCATTGTGAAGATGGTACCGAATATATACTACGTGCAGGTATTAAAGCTCTTTTAATTGAAATCAATGAACGAC TTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1153955: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11539552247169AA509292MBAFCX9F01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 14:31:7 on Sat 18 Nov 117.